Vertheless, as Golgi Epsin is expected to be get INCB-039110 required for Wingless secretion, we tested whether or not lqfR/tel2 activity is required. Port et al., 2008 showed that cell clones in the wing disc lacking the retromer protein Dvps35 accumulate Wingless and we were able to replicate this result (Fig. 8A,A9). In contrast, lqfR/tel2 null clones have wild-type Wingless levels (Fig. 8B,B9) and we infer that Wingless is secreted normally from the mutant cells. This result is consistent with the observation that Tel2 expression rescues the lqfR/tel2 null mutant phenotype. Moreover, weOnly Tel2 Portion of Fly EpsinR/Tel2 Is EssentialThere are mutant phenotypes of lqfR mutant flies that are
not easily explained by a loss of Wingless signaling [32]. Moreover, recent results link the function of LqfR/Tel2 to a PIKK complex [56]. Nevertheless, the results presented suggest that
the association of Tel2 with adherens junction proteins prevents the accumulation of excess E-cadherin at the plasma membrane which would otherwise sequester Armadillo and prevent efficient Wingless signaling (Fig. 9). Further experiments are required to determine precisely how Tel2 activity affects E-cadherin levels. It is interesting that loss of Tel2 activity in C.elegans phenocopies, at least in part, loss of Wnt signaling proteins rather than loss of PIKK activities [7]. The results presented here pave the way for genetic experiments to determine whether or not Tel2 activity in Drosophila always involves PIKK complexes.Materials and Methods Drosophila strainsThe following mutations were used: lqfRP (FBal0230310), lqfRD117 (FBal0191038), Df(3R)Exel6191 (Fab0038246), ds38k (FBal0028156), arm3 (FBal0000712), arm8 (FBal0000716), vps35E42 (FBal0221801), wgI-17 (FBal0018509). The following transgenic lines were used: Actin5C-gal4 (FBti0012293), ey-gal4 (FBti0012711), EGUF (FBti0012712, FBti0012284), hs-flp (FBti0015982), ey-flp (FBti0015982), FRT82B 15755315 (FBti0002074), FRT42D (FBti141188), ubi-gfp (FBti0012695, FBti0015577), ds-lacZ (FBal0045522), GMRhid (FBti0012710), UASt-lqfRaFL-gfp [32], UASt-lqfRaENTH-gfp [57]. The following transgenic lines (on chromosome 2) were generated: UASt-6xmyc-lqfRaFL, UASt-6xmyc-lqfRaDENTH, UASt-6xmyc-lqfRaexons1-5, UASt-6xmyc-lqfRaexon6, UASt-6xmyc-lqfRb. Chromosomes used are indicated in the figure legends.Figure 7. Coimmunoprecipitation of LqfRa and Wingless pathway proteins. Shown is a blot of protein extracts, before and after immunoprecipitation, from embryos expressing either LqfRaFL-GFP or LqfRaENTH-GFP as a negative control. The LqfR protein fusions were expressed from UAS transgenes using an Actin5C-gal4 driver. The two leftmost lanes (a-GFP IP) are immunoprecipitates using GFP antibodies, and the 301-00-8 rightmost lanes (3 input) are aliquots of the 1326631 protein extracts used, loaded to show that equivalent amounts of protein were present in each extract subjected to immunoprecipitation. doi:10.1371/journal.pone.0046357.gTransgene construction and transformationDNA fragments for four of the lqfR P element constructs were generated as follows. First, the template pUASt-lqfRa-gfp [32] was used with the following primer pairs to amplify four different products: lqfRaFL: F: 59- CACCGTGGATAAATTCATCAGCATGTGGAAAG R: 59- TTAGGCAGCCTGTTCCATGGCG lqfRaDENTH: F: 59- CACCGTGGATAAATTCATCAGCATGTGGAAAG R: 59-TTAGGCAGCCTGTTCCATGGCG lqfRaexon6: F: 59-CACCGCTGTTGAAGAGCAGTTGGCATCC R: 59-TTAGGCAGCCTGTTCCATGGCG lqfRb: F: 59- CACCATGCACGTGGTGGATAAATTCATCAG R: 59- TTATCATTGAAA.Vertheless, as Golgi Epsin is expected to be required for Wingless secretion, we tested whether or not lqfR/tel2 activity is required. Port et al., 2008 showed that cell clones in the wing disc lacking the retromer protein Dvps35 accumulate Wingless and we were able to replicate this result (Fig. 8A,A9). In contrast, lqfR/tel2 null clones have wild-type Wingless levels (Fig. 8B,B9) and we infer that Wingless is secreted normally from the mutant cells. This result is consistent with the observation that Tel2 expression rescues the lqfR/tel2 null mutant phenotype. Moreover, weOnly Tel2 Portion of Fly EpsinR/Tel2 Is EssentialThere are mutant phenotypes of lqfR mutant flies that are not easily explained by a loss of Wingless signaling [32]. Moreover, recent results link the function of LqfR/Tel2 to a PIKK complex [56]. Nevertheless, the results presented suggest that the association of Tel2 with adherens junction proteins prevents the accumulation of excess E-cadherin at the plasma membrane which would otherwise sequester Armadillo and prevent efficient Wingless signaling (Fig. 9). Further experiments are required to determine precisely how Tel2 activity affects E-cadherin levels. It is interesting that loss of Tel2 activity in C.elegans phenocopies, at least in part, loss of Wnt signaling proteins rather than loss of PIKK activities [7]. The results presented here pave the way for genetic experiments to determine whether or not Tel2 activity in Drosophila always involves PIKK complexes.Materials and Methods Drosophila strainsThe following mutations were used: lqfRP (FBal0230310), lqfRD117 (FBal0191038), Df(3R)Exel6191 (Fab0038246), ds38k (FBal0028156), arm3 (FBal0000712), arm8 (FBal0000716), vps35E42 (FBal0221801), wgI-17 (FBal0018509). The following transgenic lines were used: Actin5C-gal4 (FBti0012293), ey-gal4 (FBti0012711), EGUF (FBti0012712, FBti0012284), hs-flp (FBti0015982), ey-flp (FBti0015982), FRT82B 15755315 (FBti0002074), FRT42D (FBti141188), ubi-gfp (FBti0012695, FBti0015577), ds-lacZ (FBal0045522), GMRhid (FBti0012710), UASt-lqfRaFL-gfp [32], UASt-lqfRaENTH-gfp [57]. The following transgenic lines (on chromosome 2) were generated: UASt-6xmyc-lqfRaFL, UASt-6xmyc-lqfRaDENTH, UASt-6xmyc-lqfRaexons1-5, UASt-6xmyc-lqfRaexon6, UASt-6xmyc-lqfRb. Chromosomes used are indicated in the figure legends.Figure 7. Coimmunoprecipitation of LqfRa and Wingless pathway proteins. Shown is a blot of protein extracts, before and after immunoprecipitation, from embryos expressing either LqfRaFL-GFP or LqfRaENTH-GFP as a negative control. The LqfR protein fusions were expressed from UAS transgenes using an Actin5C-gal4 driver. The two leftmost lanes (a-GFP IP) are immunoprecipitates using GFP antibodies, and the rightmost lanes (3 input) are aliquots of the 1326631 protein extracts used, loaded to show that equivalent amounts of protein were present in each extract subjected to immunoprecipitation. doi:10.1371/journal.pone.0046357.gTransgene construction and transformationDNA fragments for four of the lqfR P element constructs were generated as follows. First, the template pUASt-lqfRa-gfp [32] was used with the following primer pairs to amplify four different products: lqfRaFL: F: 59- CACCGTGGATAAATTCATCAGCATGTGGAAAG R: 59- TTAGGCAGCCTGTTCCATGGCG lqfRaDENTH: F: 59- CACCGTGGATAAATTCATCAGCATGTGGAAAG R: 59-TTAGGCAGCCTGTTCCATGGCG lqfRaexon6: F: 59-CACCGCTGTTGAAGAGCAGTTGGCATCC R: 59-TTAGGCAGCCTGTTCCATGGCG lqfRb: F: 59- CACCATGCACGTGGTGGATAAATTCATCAG R: 59- TTATCATTGAAA.